Human Variation and Race

1.      Although I have lived in southern California my entire life and have experienced summers where temperatures can be in excess of 100F, I feel like I will never be used to the heat; However, earliest hominins evolved in the type of weather I have always lived in- mostly warm to hot woodlands and savannas of East Africa. Over time, hominins have evolved and adapted to heat to keep our bodies at optimal temperatures as to not do damage to our internal organs and our brains. The dangers of heat are very real. Just think about how many people suffer from heat stroke and severe dehydration during the summer or during sporting events. Heat can even cause death.

2.      One short term adaptation that humans have to negate the effects of heat on the body is perspiration or sweating. Humans have the ability to lose heat through the body’s surface through evaporative cooling – as humans sweat; the salt and water is evaporated from the surface of your skin draws heat away from the body. This is the most important way humans can cool down but sweating can also come at a cost. Sweating for prolonged amounts of time can greatly affect the composition of the body. During perspiration, humans lose both water and salt – both vital to life. Sweating can only be used efficiently for heat dissipation for a relatively short time before it actually becomes dangerous. For example, if a person is doing hard manual labor or intense exercise in extreme heat, it is possible to lose up to 1.5L of water and salt per hour through perspiration. For an average person, this is about 1.5% of total body weight and if a person loses 10% of body weight due to perspiration, the situation can become life threatening. 

                                          

A facultative adaptation that humans have to heat is vasodilation. Vasodilation is occurs when capillaries near the skin’s surface dilate to increase blood flow to the skin (This might cause a flushing effect when it occurs so skin looks red). Vasodilation essentially pulls heat from the center to the body to the skin so that it can radiate into the surrounding air, cooling the internal temperature of the person.

                                      

A developmental adaptation to heat is human body shape. People who live in warmer areas tend to be slimmer, and have elongated arms and legs so that the surface area of their skin is greater and can promote heat loss. The larger surface area of your skin, the more effective things like vasodilation will be in promoting heat loss.

                                           

A cultural adaptation to heat is air conditioning! Most people who live in warmer areas and extremely humid areas (in many first world countries) use air conditioning to control the climate within their homes and offices. When temperatures reach over 110 F in the summer, being able to escape the heat by going into an air conditioned building is a welcome rest for your body.

                                                

3.      The benefit of studying human variation from this perspective is that it really exemplifies how environment affects natural selection. Different races might have different skin colors or body shapes specifically as a result of adapting to their environment. This information would be helpful to us by showing us what climate we are adapted to and any precautions we might need to take to protect ourselves from the environment. For example, I am extremely pale and freckly with light eyes yet I live in an environment that is very ho and sunny. I need to wear sunscreen everyday to protect myself from skin damage and potentially cancer, whereas someone with darker skin might not need to worry about sunscreen or sun damage as much.

4.      I would use race strictly to outline a region where a group of people came from because their environment affected the adaptations that were needed for survival. I think in the current cultural and political climate, the best benefit to studying human variation from this perspective is that people might have a more enlightened view of other “races or ethnicities.” That “race” is not simply the color of someone’s skin, but that it has to do with variations and adaptations needed for survival and in that way, we are all the same. I think that some people perceive different races to be different “species.” People sometimes look at different races like they are comparing birds and fish. I think it would also be good starting point for understanding different cultures as well because adaptations does influence culture whether it has to do with food, dress, housing, lifestyle etc. It is all necessary for survival. 

How We Communicate....

Part 1

Communication and conversation without writing or speaking is difficult and very limited. I had a conversation with one person and we were only able to express very basic ideas, wants, or needs to each other using gesturing. We used a lot of pointing and imitation; For example- pretending to eat something to signify that we were hungry but even that got a little confusing. The biggest limitation was not being able to speak about anything abstract, ideas etc. Everything included in the “conversation” was very literal.

I think I was more in control of the conversation because I was constantly thinking about what my partner and I could “talk” about. It was difficult to keep conversation flowing since it was impossible to share ideas or feelings other than “happy” with a smile or “angry” with a frown. I asked more questions than my partner; however they tended to only require yes or no answers. After I ran out of questions, I began communicating things like “I like dogs” but only because I had a dog in the room to point to. I think a good conversation would include a balance of power between two individuals but because I was the person with the agenda (to complete the assignment), I took over the conversation to ensure my partner and I were communicating in some form.

I think that if my partner and I were from two different cultures, one that had language and one that did not, the overall tone of the “conversation” might have been negative. The culture that has language has an advantage in communicating complex ideas because they have words to describe thoughts and feelings that gestures cannot communicate. The culture with the language might think that the culture without symbolic language is less sophisticated and probably not very smart in comparison to themselves.

This might be a stretch, but the example I can think of is babies and adults. Babies have no way to communicate except for crying and gesturing (when they are a little older). They can only communicate when they are happy or sad, while their parents talk to the babies all day long. This does not create any negative situations because adults are aware that their children cannot yet communicate with speech or writing but the limited communication would be similar to that of the culture that had language and the culture that did not. Other than this example, I cannot think of any modern culture that does not have at least some type of symbolic language (ASL etc) to communicate effectively with other people.

Part 2

Part two of the language experiment really was more difficult than I thought it would be. My partner and I discussed different movies and characters that we liked and during the conversation, I realized that inflection in your voice and body movements greatly affect how your message is received. For instance, saying “Iron man is in that movie” with no excitement in your voice or body language means something completely different than if you were to raise your voice and jump up and say “IRON MAN WAS IN THAT MOVIE!!!” The first was a statement of fact, the second was an exclamation denoting excitement and expressing that you REALLY like Iron Man. It was difficult for my partner and me to completely understand each other unless opinions were explicit like “I like Iron Man” or “I do not like the Hulk.”

The experiment shows that body language and tone of speech is extremely important in communication. This helps to show if we are passionate about something, or if we are upset, bored, etc. It helps to express a wide range of emotions and also keeps our “audience” interested in what we are saying.

The adaptive benefit of reading body language is that you are able to communicate more easily with people who speak different languages or are from different cultures. This allows people from different places to interact even though they may not speak the same language. This may help in acquiring resources, or survive in an unknown place. It could even help people reproduce successfully because they are able to communicate beyond just language. Many emotions and intentions can be expressed through body language such as if a person wants to hurt you or help you. If a person appears threatening or docile. Although body language cannot replace the spoken word, it is a universal mode of communication.

I think there are people who have difficulty reading body language. A good example would be someone who has Asperger’s syndrome as they are not able to pick up on body language or social cues and cannot replicate them in their own communication. A person with Asperger’s would also be a good example of when body language may not be reliable in providing information about how the person is feeling or thinking at the time. 

The Piltdown Man

The Piltdown hoax was the biggest hoax in scientific history that we know of. It began when a laborer was digging in ground and came across part of a skull near Piltdown, England and brought it to amateur archaeologist Charles Dawson for further investigation. Dawson thought that the skull was much thicker than a normal human skull and could be very significant in the evolution of humans. He took it to the Natural History Museum of London to show his findings to Arthur Smith Woodward during the winter of 1912.

Up until this point in time, there had been no discoveries of prehistoric man in England. There had been discoveries in Germany, France and Spain, but nothing in Britain. There was a rivalry between Britain and Germany and World War I had just intensified it. As a result, Arthur Smith Woodward posited that this discovery could prove that Britain was the birthplace of the human race so he set out with Dawson back to Piltdown to find more bones to support their theory. Soon other artifacts and bones were found, specifically a jaw with human like teeth and eventually a canine that further supported Dawson and Woodward’s claim of having found the “missing link” in human evolution. Soon the news of the “missing link” has been spread across Europe and to the U.S. The discovery met opposition and weariness almost everywhere it was discussed. The bones of the skull did not match the bones of the jaw and there were missing pieces that would be crucial in determining if the bones even belonged to the same mammal originally. Many scientists from Britain, on the other hand, fully supported the discovery based on the reputation of the man and organization stating that the Piltdown man was real.

For 40 years after the discovery, there was talk of the Piltdown man being a hoax. Then, in 1953 a man by the name of Kenneth Oakley proved it was hoax by performing a chemical test on the bones to determine the age. It appeared that the bones were much younger than originally thought and further testing would reveal that the skull was from a human and the jaw from an ape. It was also discovered that the bones had been filed and stained to obtain the desired appearance that they were from the same mammal and were older than they were. The Piltdown man had been revealed as a carefully orchestrated hoax and embarrassed the scientific community of Britain who stoutly believed in it’s significance. Some scientists had even based their life’s work on the discovery of the Piltdown man and the belief that it was the “missing link.”

Had the Piltdown man been real, it would have proven that men descended directly from apes. That they are our ancestors when in fact, this is not true. Humans and Chimpanzees share a distant ancestor but the evolution of each species has changed greatly over time. Humans and apes have similar lineages but a Chimpanzee did not suddenly transform into a human over the course of hundreds of years. The Piltdown man, the “missing link”, would have created a different understanding of evolution. People would look at it as a straight line (a chain of events that show how each species evolved into another species) instead of looking at evolution as a tree with many branches in which each species may share a common ancestor but evolved separately from those species with which they may share traits.

The Piltdown man hoax was essentially the result of pride, greed, and arrogance, perhaps even blind ambition. Dawson was an amateur archaeologist who gained respect and notoriety within royal circles with each new discovery and Woodward was already a well-respected paleontologist at the Natural History Museum of London. Dawson’s motives might have been greed as the notion of wealth and reputation often appeared to drive his actions. Woodward wanted to bring notoriety to his museum and put Britain on the map as far as important human discoveries were concerned. Britain was constantly competing against Germany and Britain finally something to “prove” that the first man was an Englishman. It is also thought that Woodward was so invested in the idea of the “missing link” that he would have readily believed just about anything that supported his findings. There were also possible other players in the hoax that had different motives like Sir Arthur Conan Doyle and Martin Hinton. Sir Arthur Conan Doyle, creator of Sherlock Holms, was also in the equation during the discovery and presentation of the Piltdown man. It is believed that he might have done the forgery as retribution for his waning reputation with England’s high society. In addition to being an author, Doyle was a doctor who believed in mysticism and the existence of spirits and ghosts. Many important figures in English society had started to discredit Doyle because of his beliefs and he felt unfairly attacked. Finally, Martin Hinton was a junior scientist under Woodward at the Natural History Museum and a bit of a joker. He had a rivalry with Woodward and is suspected of being involved with the staining of the bones as a malicious joke to undermine Woodward’s reputation. Again, pride and jealously is the culprit in this scenario.

One of the positive outcomes of the Piltdown man hoax was how it showed the importance of the scientific method. Dawson and Woodward found bones, made assumptions, and communicated it as fact. Oakley used the scientific method to disprove the theory. He tested their hypothesis, analyzed the results and disproved the information that had been communicated earlier. Oakley used a form of relative dating called fluorine analysis to prove the age of the bones. Fluorine analysis measures the amount of fluorine that had been absorbed by the fossils from the groundwater in the area. If the bones were deposited in the area around the same time, they should have contained the same amount of fluorine. Oakley proved that the fluorine levels in the bones were not the same and that the skull was actually significantly older than the jaw bone. The discrepancy in the fluorine contest of the bones led scientists to examine the bones even closer and that is when they determined that the bones had been altered with files and stain to give the appearance that they were the same age and from one mammal instead of two.

Overall, the human factor greatly impacted the information communicated about the Piltdown man. The people involved with the bones were probably too prideful to admit that their findings may have been incorrect. For those thought to be involved in creating the hoax, again their pride and reputation kept them from telling the truth about what had happened. The entire incident had gained too much attention for any of them to risk their reputations and livelihoods to bring the truth to light. On the one hand, It is impossible to remove the human factor from science completely but the scientific method is able to negate many of the problems that may arise from it. By being required to test and prove the hypothesis for it to be considered reliable, many of the issues arising from pride or blind belief are taken out of the equation. On the other hand, I do not believe that the human factor should be removed from the science completely. Without creative people with inquiring minds, who will come up with the questions to be asked? Who will seek out new information or make discoveries? Curiosity is the only reason that we know so much about the world today.

This particular historical event should tell us not to believe everything we hear. Had the discovery gone unquestioned, it is possible that everything we know about evolution today would be wrong. It is very important for people to do their own research and draw their own conclusions about many things. Even certain scientific studies today are too heavily influenced by the people funding them and often produce skewed results. I would not know the first thing about trying to disprove a study about whether or not vaccines cause autism for example, however this idea can be applied to much in our modern everyday lives. Every time I turn on the news there is misinformation and the same applies to social media like Facebook, twitter, tumbler etc. Never take anything at face value. Approach everything critically so that you can do your own research and form your own conclusions.

Homologus and Analogous Traits.

For your homologus traits provide the following information:

a.      Briefly describe the two different species that possess the homologus trait.

My comparison for homologous traits will be between a penguin and a seagull.

Penguins are flightless birds that live half of their lives in the ocean and half of their lives on land. Seagulls are airborne birds that live on land. Both animals lay eggs to reproduce and have beaks, wings, and feathers. The major difference is that penguins will spend months of each year swimming, while seagulls will be flying. Although seagulls are found near the ocean around the world, they must make their nests on land. Meanwhile, penguins will spend about half their lives at sea coming ashore only to mate and to molt.

b.     Describe the homologus trait of each species, focusing on the differences in structure and function of the trait. Why do these homologus traits exhibit differences between the two species? Make sure your explanation is clear and complete.

There are two homologous traits that both birds have but have evolved over time to adapt to their environment. First, both birds have feathers but a seagull’s feathers are much larger than a penguin’s feathers. A seagull’s feathers are essential for flight. Like the wings of an airplane, the feather is broader on one side and taper down to the other side providing lift for the seagull when it flies. On the other hand, penguins are flightless animals and their feathers are much smaller and closer together as their primary purpose is insulation from water and cold. A penguin also has so many more feathers than the average bird that it almost looks like they have fur.

Secondly, both birds have wings. A penguin’s wings have evolved into a flipper where the bones are much denser and closer together forming something more like a “paddle” to help propel the penguin through water. Their wings or “flippers” are too heavy to support flight. Alternately, the bone structure in a seagull’s wing is much more elongated and the bones are less dense as to not hinder flight.

  

c.      Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologus trait?

Both penguins and pigeons descended from a species of bird long ago. They have the same traits in their body structures – wings and feathers and they also reproduce in the same way. Both birds evolved to adapt to their environment. A seagull lives on land and requires flight (wings and feathers) to find food and shelter while a penguin lives in the ocean and requires flippers and special feathers to insulate them for survival.

d.     Provide an image of each species in this comparison.

For your analogous traits provide the following information:

Briefly describe the two different species that possess the analogous trait.

Two species that have an analogous trait are penguins and sharks. They both have fins or fin-like structures.

Penguins are flightless birds that typically live in the southern hemisphere – usually around Antarctica. They spend half of their lives on land and half of their lives in the water.  They are very social animals and usually live in large colonies together.

Sharks are fish that live in every ocean on the planet. Most sharks live in salt water although there are a few breeds that can live in brackish water as well. They can be either very solitary animals or very social animals depending on the type of shark. Sharks also reproduce by laying “eggs” and in much smaller numbers than other species of fish.

a.      Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species.

The analogous trait I would like to focus on are fins (sharks) and flippers (penguins). Penguin’s flippers were adapted from wings to allow them to live and hunt in water. Their flippers are flat and broad with a tapered shape and are used primarily for propulsion through water.

Sharks have several types of fins that they use to propel them through the water and assist in direction. Two of the types of fins include pectoral fins and caudal fins. Pectoral fins are by the head and are used for direction and to help keep the sharks from sinking. The caudal fin is essentially just the tail of the shark and is used for propulsion. Both of these fins look similar to a penguin’s flipper. These fins are flat, broad and tapered in shape just as a penguin’s flippers are.

b.     All pairs of organisms share some common ancestor if you go back far enough in time. Could the common ancestor of these two species have possessed this analogous trait? How do we know these traits are analogous and not genetically related from common descent? (5 pts)

We know these traits are analogous because penguins are birds while sharks are fish and they could not have come from the same species. Both developed these traits to navigate their environment. Penguins evolved from their feathered air born friends so that they could survive part of their lives in the water. Sharks developed their different types of fins to better live in their environment efficiently.

c.      Provide an image of each species in this comparison.

Protein Sythesis Blog Post

My DNA molecule:

 

CTTCTACACTGAACGCAAGTTAAACGCAAGCCCCAAATGCATCGGGA

Charles Darwin and Thomas Malthus

For our first assignment, we are discussing "Historical Influcenes." Here are my thoughts:

I believe the person who most influenced the development of Charles Darwin’s theory of Natural Selection is Thomas Malthus. One could say that the without the ideas presented in Malthus’ “Essay on the Principle of Population,” Darwin’s theory would have never come to exist.

Malthus was a 19^th century English economist who became concerned with humankind’s ability to “outgrow” their resources. In his “Essay on the Principle of Population,” Malthus discussed animals’ ability to reproduce at exponential rates- rates that their resources could not support. This inevitably led to lower chances of survival for certain animals as they had to compete for their food. He posited that people would soon face the same challenges. He noted that people are capable of increasing their food production to support a growing population, but that the rate of increase would always be considerably less than the increase in population. He stated that dire consequences for this occurrence would include famine, poor health, and war stemming from competition for resources and food. Those who were successful in obtaining the food and resources needed for prosperous life will go on to reproduce and thrive, those who are not successful, will starve and die. This is essentially the ground work for Darwin’s theory of evolution.

Two key points that are the cornerstones of Darwin’s Theory of Evolution are supported by the ideas of Thomas Malthus. Like Malthus, Darwin believed that organisms have the potential to reproduce exponentially but are ultimately limited by the availability of resources. Though Malthus was focused primarily on human population, he states in his essay that if human population was left unchecked by limited resources resulting in disease, hardship, famine or self-constraint (birth control, marrying later in life), it would double every 25 years (An Essay on the Principle of Population, II.16).

These two ideas – that populations have the ability to grow exponentially and that they are only limited by resources- are the building blocks of the Darwin’s theory of evolution. Without the identification of what is limiting populations, Darwin would not have been able to theorize about the overall effects on a species; “who” successfully reproduced and why, a species’ ability to adapt, or the inheritance of desirable traits. In fact, Darwin even credited Thomas Malthus for the ideas presented in his essay.

From Charles Darwin’s Autobiography:

“In October 1838, that is, fifteen months after I had begun my systematic inquiry, I happened to read for amusement Malthus on Population, and being well prepared to appreciate the struggle for existence which everywhere goes on from long- continued observation of the habits of animals and plants, it at once struck me that under these circumstances favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The results of this would be the formation of a new species. Here, then I had at last got a theory by which to work;”

                (http://www.gutenberg.org/files/2010/2010-h/2010-h.htm)

One final note on Malthus and Darwin that I found interesting: Malthus was an English cleric, a member of the clergy. Although he believed that resources were the inhibitors to human population growth, he sternly believed that this was God’s will. I find it ironic that Darwin’s theory was influenced so greatly by a non-secular scholar since Darwin’s work was heavily scrutinized by the religious community. Darwin postponed many of his publications as to not upset the church. In fact, the influence of the church could have even caused Darwin to lose credit for his theory of natural selection to Alfred Wallace. Ultimately, it was competition that led Darwin to publish his ideas (survival of the fittest?).

 Additional Web Sources:

http://www.gutenberg.org/files/2010/2010-h/2010-h.htm

http://www.britannica.com/biography/Thomas-Robert-Malthus

http://www.econlib.org/library/Malthus/malPop1.html#Chapter II

http://www.econlib.org/library/Enc/bios/Malthus.html